Syndecan-4 is required for cell surface targeting of TG2 and the development of kidney fibrosis in chronic kidney disease. TG2 TG2 Post del 30/12/2020. Cells were rinsed in ice‐cold phosphate‐buffered saline (PBS) and collected in lysis buffer containing 20 mM Tris–HCl pH 7.4, 150 mM NaCl and 1% Triton X‐100 with protease inhibitor cocktail. The above‐reported findings prompted us to investigate whether the effects of TG2 on HSF1‐mediated HSP70 transactivation may contribute to CF pathogenesis in the mouse model. Sheared chromatin was diluted in ChIP dilution buffer, and 100 μg was immunoprecipitated with magnetic protein G beads and 3 μg of primary antibody (α‐HSF‐1, Millipore ABE1044) overnight at 4°C by head‐to‐head rotation. TG2 function/regulation has been implicated in the pathogenesis of several major human diseases, such as cancer and metastasis formation, cystic fibrosis, coeliac disease and neurodegenerative disorders 49. Transglutaminase type 2 (TG2) is a multifunctional, ubiquitously expressed member of the TG family that catalyses post‐translational modifications of proteins through both Ca2+‐dependent and Ca2+‐independent reactions 1. Tg2 Post: La #politica ha un compito fondamentale: scegliere. ), grant from Telethon (GGP14095 to C.S. Co‐immunoprecipitation analyses revealed that TG2 interacts with HSF1 just after HS (Fig 4A and B). MP and LM conceived the project and designed the experiments. TG2−/− MEFTG2 stably reconstituted with the unmutated TG2 was obtained as previously described 4. Both treatments are known to cause the accumulation of misfolded proteins and the consequent induction of HSP70 26-28. TG2 Venti anni fa la morte ad Hammamet di Bettino Craxi, primo socialista per quasi quattro anni alla guida di un governo, quando l’Italia era la quinta potenza industriale del mondo. A median filter was applied to the images to reduce the background noise before threshold analysis. Dezember 2020 21:00 RAI 2 Mittwoch, 2. Western blot and densitometric analysis of HSP27 protein levels in nasal epithelial cells, from CF patients (, Western blot of HSP70 in brushed nasal epithelial cells freshly collected from F508del CFTR homozygous patients (. Nuclei were lysed with a nuclear lysis buffer and chromatin was sheared by sonication (Diagenode, Belgium, 30‐s pulses, 30‐s rests) on ice. Introduction. These conditions should provide a relative humidity of 75%, which favours efficient HS 63, 64. Stimulations with forskolin, CFTR inhibitor 172 and amiloride were performed as described 17. Montag, 30. 16.11.2020, 21:00 - 21:20 Uhr. Contact Form. Nuclear and cytosolic extracts were obtained using the NE‐PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). Dezember 2020 21:00 RAI 2 Freitag, 4. About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features It is important to note that, so far, no model was proposed to explain how the TG2 inhibition regulates transcription under proteomic stress, but based on the present study it is possible to suggest that TG2 might exert its transcriptional function through modulation of HSF1 activity. Quantification of co‐localization was performed on six sets of images acquired with the same optical settings and excluding the consideration of autofluorescence. Ora in diretta su Rai Due, buona serata Amici. Likewise, HSF1 and the HSPs have been shown to play a key regulatory role in dictating the fate of their abnormal client proteins versus the proteasome and/or autophagy 31. All authors read and edited the manuscript. La splendida Manuela Moreno nell'edizione serale del TG2 Post in Full HD (1080p) This video is unavailable. Hydrogen atoms were added to the protein structure using standard geometries. Interestingly, among these TG2‐sensitive genes, many are known to be also controlled by HSF1 47. Chamber solution was buffered by bubbling with a mixture of 95% O2 and 5% CO2. 23:30 RAI 2. Un appuntamento con l'attualità dell'ultimo minuto, gli approfondimenti, la cronaca. The protein disulphide activity of TG2 post‐translationally modifies HSF1. Finally, we measured CFTR‐dependent chloride secretion ex vivo in segment of the ileum mounted in Ussing chambers. Tg2 Post Awards and Nominations. Blots were blocked in 5% non‐fat dry milk in T‐PBS (PBS + 0.05% Tween‐20) for 1 h at room temperature and then incubated overnight with the described antibodies. TG2+/+ and TG2−/− MEFs, exposed to heat shock, were crosslinked in 1% (vol/vol) formaldehyde for 10 min at room temperature and quenched with 125 mM glycine for 5 min. Testimonianze, retroscena, racconti su una figura che continua a dividere, che ha dato una svolta alla storia italiana. According to this, phosphorylation of HSF1 at S326, a hallmark for HSF1 activation, occurred mainly in CF patients and largely decreased with cysteamine (Fig 7E and F). M5sParlamento 608 views New 25:27 Danilo Toninelli (M5S) a L'aria che Tira 5/5/2020 - … Vi ripropongo il bel dibattito di ieri sera a #Tg2Post. In the last few years, it has been established that TG2 switches its 3D structure from a nucleotide‐bound “closed” to the transamidation/PDI prone “open” conformation 5, 6. The authors also acknowledge the support of the grant from the Russian Government Programme for the Recruitment of the Leading Scientists into the Russian Institutions of Higher Education 14.W03.31.0029 to MP. A sera disse: «Non sto per Eluted DNA was purified and subjected to qPCR analysis with primers directed against the HSP70.3 promoter region (mHSP70.3 dHSE Fwd 5′‐ACCCTCCCCCTCAGGAATC‐3′; mHSP70.3 dHSE Rev 5′‐TGTCCAGAACTCTCCAGAGGTTT‐3′). Featured Post Search This Blog. Francesca Romana Elisei, conduttrice di Tg2 Post ogni sera su Raidue, ieri esibiva un look sexy e dark. PREPORUKE. To characterize how TG2 could modulate HSF1 activation, we first verified whether the two proteins could interact. August 1983 vereidigt und regierte Italien bis zum 1. In agreement with this novel function of TG2, it was previously described that stressed cells lacking TG2 are defective in the clearance of ubiquitinated protein aggregates thus predisposing them to death 12, 48. TG2, through its protein disulphide isomerase activity, triggers the trimerization and activation of HSF1. To this aim, we analysed the trimerization of HSF1 in TG2+/+ and TG2−/− MEF after heat shock (Fig 5A) or proteasome inhibition (Fig 5B) using or not reducing agents. Soc. Ultimately, F508del CFTR, retained in the ER, is ubiquitinated and retrotranslocated to the cytosol where it undergoes proteasomal degradation by the ER‐associated degradation (ERAD) pathway 53-56. and you may need to create a new Wiley Online Library account. Cells were lysed in a buffer containing 150 mM NaCl, 50 mM Tris–HCl pH 7.5, 2 mM EDTA, 2% NP‐40 and freshly added protease inhibitor cocktail. Durata: 00:25:49; Andato in onda: 30/12/2020; Visualizzazioni: Commenta; Mail to; Preferiti; Correlati; Sito. Intestinal HSP70 expression was increased in CFTRF508del/TG2+/+ mice over WT (CFTRwt/TG2+/+) controls, and this HSP70 overexpression was reduced in CFTRF508del/TG2−/− mice (Fig 7A). Dezember 2020 21:00 RAI 2 Donnerstag, 3. Sempre molto interessante di cosa si parla . Cysteamine administration was performed in CFTRF508del mice via gavage with cysteamine (60 mg/kg in 100 ml saline/day) or 100 ml saline/day for 5 consecutive day/week for 5 weeks. TG2+/+ MEF, grown on coverslips, were subjected to heat shock, then washed with PBS and fixed in 4% paraformaldehyde for 10 min at room temperature. Caption: The endoplasmic reticulum (ER) makes physical contacts with most cellular organelles. Western blot analysis of HSP70 expression (upper) and HSF1 nuclear translocation (lower) in TG2, Densitometric analysis of HSP25 and BAG3 protein in TG2, Western blot analysis and densitometric analysis of HSP70 protein levels in the intestine tissue lysates of CFTR, Western blot and densitometric analysis of HSP70 and HSP40 protein levels in nasal epithelial cells, from CF patients (, Western blot analysis of HSF1 and phosphorylated HSF1 at Ser326 in nasal epithelial cells, from CF patients (, Densitometric analysis of HSF1 polymers formation and HSF1 phosphorylation in nasal epithelial cells, from CF patients, cultured, Transglutaminase 2: an enigmatic enzyme with diverse functions, Transglutaminases: crosslinking enzymes with pleiotropic functions, Cellular functions of tissue transglutaminase, TG2 transamidating activity acts as a reostat controlling the interplay between apoptosis and autophagy, “Tissue” transglutaminase contributes to the formation of disulphide bridges in proteins of mitochondrial respiratory complexes, Transglutaminase 2: a molecular swiss army knife, The transglutaminase type 2 and pyruvate kinase isoenzyme M2 interplay in autophagy regulation, Transglutaminase 2 interaction with small heat shock proteins mediate cell survival upon excitotoxic stress, Identification of DNAJA1 as a novel interacting partner and substrate of human transglutaminase 2, CHIP‐mediated degradation of transglutaminase 2 negatively regulates tumor growth and angiogenesis in renal cancer, Transglutaminase 2 is involved in autophagosome maturation, Type 2 transglutaminase is involved in the autophagy‐dependent clearance of ubiquitinated proteins, Transglutaminase 2 ablation leads to mitophagy impairment associated with a metabolic shift towards aerobic glycolysis, Transglutaminase type 2‐dependent selective recruitment of proteins into exosomes under stressful cellular conditions, Cystamine treatment is neuroprotective in the YAC128 mouse model of Huntington disease, The effect of cysteamine bitartrate on adiponectin multimerization in non‐alcoholic fatty liver disease and healthy subjects, A novel treatment of cystic fibrosis acting on‐target: cysteamine plus epigallocatechin gallate for the autophagy‐dependent rescue of class II‐mutated CFTR, Type 2 transglutaminase, mitochondria and Huntington's disease: menage a trois, Characterization of distinct sub‐cellular location of transglutaminase type II: changes in intracellular distribution in physiological and pathological states, Transglutaminase 2 inhibitors and their therapeutic role in disease states, Cystamine metabolism and brain transport properties: clinical implications for neurodegenerative diseases, Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia, Defective CFTR induces aggresome formation and lung inflammation in cystic fibrosis through ROS‐mediated autophagy inhibition, Restoration of CFTR function in patients with cystic fibrosis carrying the F508del‐CFTR mutation, Manipulating proteostasis to repair the F508del‐CFTR defect in cystic fibrosis, Hyperphosphorylation of heat shock transcription factor 1 is correlated with transcriptional competence and slow dissociation of active factor trimers, Proteasome inhibitor MG132 induces BAG3 expression through activation of heat shock factor 1, Inhibition of inducible heat shock protein‐70 (hsp72) enhances bortezomib‐induced cell death in human bladder cancer cells, Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators, Heat shock factors: integrators of cell stress, development and lifespan, Signal transduction pathways leading to heat shock transcription, Activation of human heat shock genes is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1, Roles of the heat shock transcription factors in regulation of the heat shock response and beyond, BAG3 affects the nucleocytoplasmic shuttling of HSF1 upon heat stress, Redox regulation of mammalian heat shock factor 1 is essential for Hsp gene activation and protection from stress, Two distinct disulfide bonds formed in human heat shock transcription factor 1 act in opposition to regulate its DNA binding activity, Redox regulation of transglutaminase 2 activity, The common variant of cystic fibrosis transmembrane conductance regulator is recognized by hsp7O and degraded in a pre‐Golgi non lysosomal compartment, Living in constant crisis–when stress management becomes the problem, Modulation of the maladaptive stress response to manage diseases of protein folding, The Hdj‐2/Hsc70 chaperone pair facilitates early steps in CFTR biogenesis, Small heat shock proteins target mutant cystic fibrosis transmembrane conductance regulator for degradation via a small ubiquitin‐like modifier‐dependent pathway, mTOR is essential for the proteotoxic stress response, HSF1 activation and heat shock protein synthesis, Uncoupling stress‐inducible phosphorylation of heat shock factor 1 from its activation, Type 2 transglutaminase in Huntington's disease: a double‐edged sword with clinical potential, Inhibition of transglutaminase 2 mitigates transcriptional dysregulation in models of Huntington disease. Importantly, restoring even < 30% of CFTR function in vivo is believed to confer a clinical benefit to CF patients 24. Scientific image by Thomas Di Mattia, IGBMC, INSERM, CNRS, University of Strasbourg. Brushes with cells were immediately transferred into RPMI 1640 medium (Invitrogen) containing 1% penicillin–streptomycin (Lonza), in 15‐ml sterilized tubes. TG2, by activating HSF1, regulates HSP70 protein expression. TG2 favour the degradation of mutant CFTR via the HSF1/HSP70 pathway. orcid.org/http://orcid.org/0000-0002-9334-4405, orcid.org/http://orcid.org/0000-0003-2919-1296. VRV and SE processed the human samples from CF patients. TG2 Post del 30/12/2020 TG2. In order to define the molecular mechanism regulating the TG2‐dependent induction of HSP70, we focused our attention on the heat‐shock factor 1 (HSF1), the main transcription factor involved in HSP70 expression. We have previously demonstrated that TG2 is involved in the assembly and clearance of ubiquitinated aggregates 12. As expected 32-34, in TG2+/+ MEF HSF1 was only present in the cytosol in basal conditions and rapidly translocated into the nucleus after heat shock or MG132 addition leading to HSP70 expression (Fig 3A–D). We also analysed freshly brushed nasal epithelial cells from two F508del CFTR homozygous patients who underwent a phase II clinical trial (EudraCT 2013‐001258‐82) with cysteamine bitartrate 17. Histogram showing Pearson's correlation coefficient to evaluate co‐localization of TG2 and HSF1. These results indicate that TG2 is required for the optimal activation of HSF1. Va in onda dal 18 febbraio 2019 ed è condotta da Manuela Moreno . Indeed, immature F508del CFTR fails to mature, does not transit to the late secretory pathway 50 and is trapped in the ER where interacts with the cytosolic chaperones, such as HSP70, as well as with the ER chaperone calnexin 38, 42, 51, 52. P.Iva 06382641006. INHALT. Subsequently, we analysed the sensitivity of these mice to the infection with Pseudomonas aeruginosa, a persistent bacteria that commonly infects and kills CF patients as a result of chronic lung inflammation. In fact, accumulating evidences show that HSF1 is activated in the nucleus as a consequence of diverse specific physiological cellular requirements and directs transcriptional programmes distinct from the heat‐shock response. Spallanzani’, Rome, Italy, Department of Biological and Environmental Sciences and Technologies (DiSTeBA), University of Salento, Lecce, Italy, Sorbonne Paris Cité, Université Paris Descartes, Paris, France, Equipe 11 labellisée Ligue Nationale contre le Cancer, Centre de Recherche des Cordeliers, Paris, France, Institut National de la Santé et de la Recherche Médicale, U1138, Paris, France, Université Pierre et Marie Curie, Paris, France, Metabolomics and Cell Biology Platforms, Gustave Roussy Cancer Campus, Villejuif, France, Pôle de Biologie, Hôpital Européen Georges Pompidou, AP‐HP, Paris, France, Department of Women's and Children's Health, Karolinska University Hospital, Stockholm, Sweden, Regional Cystic Fibrosis Center, Pediatric Unit, Department of Translational Medical Sciences, Federico II University, Naples, Italy, SCDU of Pediatrics, Department of Health Sciences, University of Piemonte Orientale, Novara, Italy, *Corresponding author. Commensurate with a key role for TG2 and HSP70 in the recovery from stress, TG2+/+ MEF exhibited a transient increase in protein ubiquitination post‐HS, suggesting successful clearance of damaged proteins, while TG2−/− MEF showed a stable elevation of protein ubiquitination (Fig 2D). By continuing to browse this site, you agree to its use of cookies as described in our Privacy Policy. All patients gave written informed consent at the time of the clinical study. was supported by “Fondazione Umberto Veronesi” and AIRC fellowships. … Un’ascesa irresistibile nel partito e nella sinistra sottratta all’egemonia comunista. The authors would like to thank Dr. E Romano from the Centre of Advanced Microscopy, Department of Biology, University of Rome Tor Vergata, for her skilful assistance in the use of the facility. Tgdue post ha visto picone e ficarra parlare del loro film , il primo matale . Lo speciale ripercorre la vita, l'esperienza umana e politica del leader socialista. A primer set amplifying an HSP70.3 intergenic region (mHSP70.3 Intergenic Region Fwd 5′‐GTGGCGCATGCCTTTGAT‐3′; mHSP70.3 Intergenic Region Rev 5′‐CTTTGTAGAACAGGCTGACCTTGA‐3′) was used as control for the ChIP. Euro 242.518.100,00 interamente versato, Cap. Soc. HSF1 polymerized only if it was phosphorylated and in the absence of calcium, which is known to interfere with the redox‐sensitive cysteines of TG2 and consequently with its PDI activity 37. Pisa, regata storica delle antiche repubbliche marinare d'Italia : L'omonima gara va in onda in diretta a cura del TG2. Moreover, in contrast to TG2+/+ MEF, the lack of HSP70 induction in TG2−/− MEF correlated to HS‐dependent apoptosis as highlighted by the activation of caspase 3 (Fig EV1). As shown in Fig 2A and B, in the absence of TG2, no induction of HSP70 occurred after HS or proteasome inhibition. Counterstaining with specific antibody was used to exclude the presence of lymphocytes, inflammatory cells and mucipar differentiation. TG2 crystal structure was retrieved from the protein data bank (PDB code: 3S3J) and processed in order to remove unwanted ligands and water molecules. WT (CFTRwt/TG2+/+) and CF mice on TG2 null background (CFTRF508del/TG2−/−) indistinguishable survived in response to PAO1 infection, while CFTR homozygous ones (CFTRF508del/TG2+/+) succumbed to infection (Fig 6B). One of the mechanisms through which eukaryotic cells adapt to intracellular and environmental stress is the heat‐shock response. In spite of differences related to cell‐ and tissue‐specific disease context, these disorders share common features of unbalanced cell adaptation to either cell autonomous or environmental stress. Eight‐week‐old mice were placed in the cage for 20 min at 42°C, after which they were transferred to a clean cage at room temperature. All the procedures in mice were approved by the Local Ethics Committee for Animal Welfare (IACUC No. The formation of three intermolecular S‐S bonds between two cysteine residues (Cys36 and Cys103) is essential for HSF1 trimerization and DNA binding. I primi passi a Milano nella politica, gli anni della scalata nel partito (a cui diede una nuova identità riformista e che rilanciò facendosi largo tra Democrazia Cristiana e Partito Comunista) e nel paese. Come raccontò il figlio Bobo, nel padre c'era «un misto di soddisfazione e di stupore». Only one binding site, defined by His 335, Asp 358, Cys 371, Phe 392 and Glu 396, resulted to be compatible and was then selected for the docking analysis. Here, we provide the first evidence that the HSF1 trimerization is mediated by the PDI activity of TG2 (Fig EV5). MEF cells were cultured in Dulbecco's modified Eagle's medium (Lonza) supplemented with 10% foetal bovine serum, 100 μg/ml streptomycin and 100 units/ml penicillin, at 37°C and 5% CO2 in a humidified atmosphere. Several unique features, including its ubiquitous expression, widespread localization, binding to and hydrolysis of guanine nucleotides, distinguish TG2 from the other transglutaminases 2. Euro 242.518.100,00 interamente versato Ufficio del Registro delle Several TG2 inhibitors can ameliorate disease phenotype, either in pre‐clinical or in clinical settings 20. Il problema è che in Italia siamo ostaggi della cultura del NO. Western blot analysis of cleaved caspase 3 and PARP, as markers for apoptotic cell death induction, and HSP70 in protein extracts of TG2. After weaning, mice were fed with a standard diet and survival rate was evaluated in the 4 weeks following. Our preliminary findings using postmortem human brain samples found increases in TG2 mRNA and protein levels in the middle frontal gyrus of subjects with autism spectrum disorder. Second In Command (2006) heute . August 1986. Number of colony‐forming units (CFU) of CFTR, TNF‐α transcription levels, quantified by qPCR, in intestine (left) and lung (right) homogenates from 10‐week‐old CFTR, Representative traces of CFTR‐dependent Cl‐ secretion measured by forskolin (Fsk)‐induced increase of chloride current (Isc (μA/cm. Here, we show a novel molecular mechanism controlling the activation of HSF1. The peculiar biochemistry of this enzyme as well as its capacity to interact with the main proteins involved in the regulation of proteostasis suggests that TG2 plays a key role in this process. By combining in vivo approaches in transgenic mice with in vitro studies, we demonstrate that TG2, by acting as a PDI, is able to activate HSF1, the master transcriptional regulator of the stress‐responsive genes. Next, to verify whether the TG2‐HSF1‐HSP70 axis was also detectable in CF patients homozygous for the F508del CFTR mutation, we examined HSP70 expression in primary nasal epithelial cells. Accordingly, quantification of HSP70 mRNA indicated that the HSP70 gene was efficiently transcribed only in TG2+/+ MEF in response to HS (Fig 5E). Twitter. Ex vivo treatment of freshly brushed patient cells with cysteamine significantly reduced the HSP70 protein levels observed in CF cells (Fig 7C). Das Kabinett Craxi I wurde nach den Parlamentswahlen vom 27.Juni 1983 am 4. It remains to be determined whether yet‐to‐be‐developed specific TG2 PDI inhibitors may replace cysteamine advantageously for the treatment of CF or other diseases linked to TG2 deregulation. The precipitated material was also treated with RNAse R at 37°C for 15 min and with 0.5 mg/ml Proteinase K at 50°C for 1 h to remove all contaminating RNA molecules and proteins. Next, we performed an in vitro assay using recombinant TG2 and HSF1 proteins (Fig 5C) to show that TG2 effectively induced HSF1 polymerization. Cysteamine is capable of controlling the consequences of TG2 overactivation in CF, improving the trafficking of the most common misfolded F508del CFTR mutant 17, 22-25. Beta verzija (2016) danas. To translate our findings in vivo and elucidate the molecular mechanisms by which TG2 regulates CF pathogenesis, we developed a new experimental mouse model carrying the F508 CFTR deletion on a TG2 null background. In addition, the enzyme interacts with several molecular chaperones and proteins involved in the folding machinery 7 including the stress‐inducible form of HSP70 (HSPA1A). The relative amounts of mRNA were calculated by using the comparative Ctmethod. Interestingly, the amount of hyperphosphorylated HSF1, shortly after heat shock, was reduced in TG2−/− MEF as compared to TG2+/+ MEF (Fig 3E). Über search.ch TG2, by activating HSF1, regulates HSP70 protein expression. By a computerized docking analysis, we found that cysteamine was able to interact with TG2 close to its active site, thus inhibiting the transamidating and the PDI activities (Fig EV4A). Indeed, in addition to its crosslinking activity, TG2 might also act as a GTP‐binding protein that mediates intracellular signalling by coupling the alpha‐1 beta‐adrenergic receptor to phospholipase C‐gamma 1 3, 4. CFTR channels present at the apical surface of the epithelium (lumen side of the tissue) were activated. Tg2 Post Puntata del 30/12/20; selected">Chi siamo; Facebook. RAI 2 | Montag | 21:00. Tel: +39 0672 594234; E‐mail: [email protected]. Con personalità come Berlusconi, Renzi, Feltri -tutti e tre a lungo intervistati da uno “speciale” del Tg2- per i quali Craxi fu premonitore, ebbe ragione quando tentò di strappare la leadership della sinistra ai comunisti, seppe vedere Another aspect of the present study is that it clarifies and extends prior observations on the role of TG2 in degenerative disorders, such as the Huntington disease (HD), in which TG2 inhibitors such as cysteamine reversed transcriptional deregulation due to the expression of mutated huntingtin 46, 47. Here, we demonstrate that TG2 regulates proteostasis and the general cellular adaptation to stress. TG2 Dossier - Bettino Craxi. Colony factor unit was enumerated 24 h later 65, 66. These data suggest that TG2 PDI activity induces the trimerization of HSF1, which in turn facilitates transactivation of the HSP70 gene by binding to heat‐shock elements (HSEs) in the promoter. GraphPad was used for statistical analysis. If you do not receive an email within 10 minutes, your email address may not be registered, TG2 genotype was assessed by PCR using primers: 5′‐ACGAGACTAGTGAGACGTGC‐3′, following the conditions 95°C for 5 min, then 35 cycles at 94°C for 1 min + 56°C for 45 s + 72°C for 1 min and then 72°C for 5 min, as previously described 62.